cdna constructs encoding the human nav1.8 Search Results


95
Alomone Labs anti na v 1 8
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Anti Na V 1 8, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc06554007-79-19-40?v=Alomone+Labs
Average 95 stars, based on 1 article reviews
anti na v 1 8 - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

91
OriGene human nav1 8 cdna
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Human Nav1 8 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pm37695396-36-6-14?v=OriGene
Average 91 stars, based on 1 article reviews
human nav1 8 cdna - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

93
Addgene inc pn3 sp1fl
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Pn3 Sp1fl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc03952860-212-88-107?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pn3 sp1fl - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

94
OriGene scn10a
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Scn10a, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc13125304-24-51-66?v=OriGene
Average 94 stars, based on 1 article reviews
scn10a - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
SignaGen pn3-hiv-2-gag plasmid
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Pn3 Hiv 2 Gag Plasmid, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc11057910-421-2-20?v=SignaGen
Average 90 stars, based on 1 article reviews
pn3-hiv-2-gag plasmid - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Chantest Inc human nav1.8
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Human Nav1.8, supplied by Chantest Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pm32524995-67-33-35?v=Chantest+Inc
Average 90 stars, based on 1 article reviews
human nav1.8 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
OriGene mouse na v 1 8
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Mouse Na V 1 8, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc06264633-619-3-11?v=OriGene
Average 90 stars, based on 1 article reviews
mouse na v 1 8 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
OriGene tggcagatgacctggaagaacc
Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at <t>http://links.lww.com/PAIN/A749</t> ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.
Tggcagatgacctggaagaacc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pm30378291-59-14-18?v=OriGene
Average 90 stars, based on 1 article reviews
tggcagatgacctggaagaacc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Alomone Labs gtx1
Three-dimensional structures of spider-derived ICK peptides. Protein Data Bank ID numbers for NMR structures of (a) ProTx-I and (b) GsMTx-4 are 2M9L and 1TYK, respectively. 3D structure models of (c) <t>GTx1-15</t> were constructed by homology modeling with ICM-PRO (Molsoft, La Jolla, CA) based on NMR structures of HnTx-IV (PDB: 1niy). (d) NMR structure of ProTx-II by Park et al. . Reprinted with permission from . Copyright: 2014 American Chemical Society. β -Sheets are indicated as green or black arrows and disulfide bonds are highlighted with yellow. Note: spider-derived ICKs have only two antiparallel β -sheets and three disulfide bonds except for ProTx-II which has only one β -sheet.
Gtx1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc04710912-32-0-4?v=Alomone+Labs
Average 90 stars, based on 1 article reviews
gtx1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation pcdna3.1-human nav1.8 (plasmid)
Three-dimensional structures of spider-derived ICK peptides. Protein Data Bank ID numbers for NMR structures of (a) ProTx-I and (b) GsMTx-4 are 2M9L and 1TYK, respectively. 3D structure models of (c) <t>GTx1-15</t> were constructed by homology modeling with ICM-PRO (Molsoft, La Jolla, CA) based on NMR structures of HnTx-IV (PDB: 1niy). (d) NMR structure of ProTx-II by Park et al. . Reprinted with permission from . Copyright: 2014 American Chemical Society. β -Sheets are indicated as green or black arrows and disulfide bonds are highlighted with yellow. Note: spider-derived ICKs have only two antiparallel β -sheets and three disulfide bonds except for ProTx-II which has only one β -sheet.
Pcdna3.1 Human Nav1.8 (Plasmid), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc09071269-23-4-8?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
pcdna3.1-human nav1.8 (plasmid) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp scn10a rn00568393 m1
Three-dimensional structures of spider-derived ICK peptides. Protein Data Bank ID numbers for NMR structures of (a) ProTx-I and (b) GsMTx-4 are 2M9L and 1TYK, respectively. 3D structure models of (c) <t>GTx1-15</t> were constructed by homology modeling with ICM-PRO (Molsoft, La Jolla, CA) based on NMR structures of HnTx-IV (PDB: 1niy). (d) NMR structure of ProTx-II by Park et al. . Reprinted with permission from . Copyright: 2014 American Chemical Society. β -Sheets are indicated as green or black arrows and disulfide bonds are highlighted with yellow. Note: spider-derived ICKs have only two antiparallel β -sheets and three disulfide bonds except for ProTx-II which has only one β -sheet.
Gene Exp Scn10a Rn00568393 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pmc11984575-85-13-40?v=Thermo+Fisher
Average 89 stars, based on 1 article reviews
gene exp scn10a rn00568393 m1 - by Bioz Stars, 2026-06
89/100 stars
  Buy from Supplier

Image Search Results


Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.

Journal: Pain

Article Title: The role of Na v 1.7 in human nociceptors: insights from human induced pluripotent stem cell–derived sensory neurons of erythromelalgia patients

doi: 10.1097/j.pain.0000000000001511

Figure Lengend Snippet: Functional sensory neurons are generated from iPS cells. (A) Differentiation scheme of iPS cells into sensory neurons with dual-SMAD inhibition (LDN193189 and SB431542), VEGF/FGF/PDGF inhibition (SU5402), Notch inhibition (DAPT), and WNT activation (CHIR99021) for 10 days (d0-d10), followed by growth factor (NGF, BDNF, and GDNF)-driven neuron maturation for 8 weeks. On maturation day M35 and M55, neurons were used for analysis. (B) Representative phase-contrast and immunofluorescence images of iPS cell–derived neurons expressing peripherin (green) and TUJ-1 (red) of IEM 1. Scale bar 100 µm. (C and D) Representative immunofluorescence images of neurons from IEM 1 stained positive for Na V 1.8 (C) (see also Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ) and TRPV1 (D) (both red) and TUJ-1 (green). Nuclei were counterstained with DAPI (blue). Scale bar 100 µm. (E) Representative calcium imaging recording performed on iPS cell–derived neurons from clone IEM 1. Neurons were stimulated with capsaicin (1 µM), AITC (100 µM), menthol (100 µM), pH 6.0, and KCl (60 mM) for 30 seconds each as indicated. Response profiles of 18 cells are overlaid. For quantification, see Supplementary Figure S3 (available at http://links.lww.com/PAIN/A749 ). (F) Representative recording of an IEM 1 neuron. Traces display the neuron's total (left) and TTX-r (right) currents, showing functional expression of TTX-r Na V channels. See also Table . (G) Representative recording of an IEM 1 neuron, showing functional expression of Na V 1.7. Total Na V current is shown before (black) and after (red) 20 minutes of application of the Na V 1.7-specific blocker ProTx-II (5 nM). Data shown in (B–E) were gathered on maturation day M35. IEM, inherited erythromelalgia; iPS cell, induced pluripotent stem cell.

Article Snippet: Induced pluripotent stem cell–derived neurons were stained with anti-peripherin (clone sc-7604; Santa Cruz Biotechnology), anti-β-III-tubulin (clone TUJ-1; R&D Systems), anti-Na V 1.8 (clone ASC-016, 1:1000, see Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ), and anti-TRPV1 (clone ACC-030, 1:1000; all from Alomone Labs, Jerusalem, Israel).

Techniques: Functional Assay, Generated, Inhibition, Activation Assay, Immunofluorescence, Derivative Assay, Expressing, Staining, Imaging

The IEM mutation changes action potential characteristics. (A) Representative action potentials recorded in IEM 2 (left) and Ctrl 2 (right) nociceptors. Action potential thresholds for each particular neuron are indicated. Dotted line represents 0 mV. (B) The RMP was −47.7 ± 2.4 mV for IEM and −39.3 ± 3.3 for Ctrl nociceptors (n = 24 and 22; P = 0.05 unpaired t test: t = 2.07, df = 44). (C) The action potential threshold was significantly lowered in IEM nociceptors (−45.9 ± 0.6 mV in IEM and −40.1 ± 2.8 mV in Ctrl; n = 23 and 21; P = 0.02, Mann–Whitney test). (D) IEM nociceptors display a stronger hyperpolarization after each action potential (−61.2 ± 0.8 mV for IEM and −45.9 ± 3.7 mV for Ctrl; n = 23 and 21; P < 0.0001, Mann–Whitney test). (E) IEM action potentials had a mean amplitude of 120.9 ± 1.7 mV, compared with 103.1 ± 4.3 mV in Ctrl nociceptors (n = 23 and 21; P = 0.004, Mann–Whitney test). (F) Action potentials in IEM nociceptors had a mean half-width of 2.3 ± 0.6 ms, compared with 8.5 ± 3.8 ms in Ctrl nociceptors (n = 23 and 21; P = 0.02, Mann–Whitney test). (G) The time from pulse onset to the action potential peak is significantly shorter in IEM nociceptors (28.6 ± 2.4 ms, compared with 56.8 ± 11.8 ms in Ctrl; n = 23 and 21; P = 0.019, unpaired t test: t = 2.44, df = 42). (H) Nociceptors for IEM patients have a steeper maximum slope of the action potential upstroke (223.7 ± 13.2 V/s, compared with 136.3 ± 29 V/s in Ctrl; n = 23 and 21; P = 0.007, unpaired t test: t = 2.83, df = 42). (I) The slope of the subthreshold depolarization is not different between IEM and Ctrl nociceptors (1.5 ± 0.1 V/s for IEM vs 1.8 ± 0.3 V/s for Ctrl; n = 23 and 21; P = 0.8, Mann–Whitney test). (J) Action potential (AP) frequency induced by increasing stepwise current injections (n = 14 for IEM and n = 5 for Ctrl; note that some traces are overlaid). None of the measured Ctrl nociceptors fired more than 2 action potentials. The current injection protocol is identical to the one in Supplementary Fig. S5b (available at http://links.lww.com/PAIN/A749 ). Neurons were held at an RMP around −70 mV and depolarized by square current injections in steps of 0.5 × rheobase to evoke action potential firing. IEM, inherited erythromelalgia; RMP, resting membrane potential.

Journal: Pain

Article Title: The role of Na v 1.7 in human nociceptors: insights from human induced pluripotent stem cell–derived sensory neurons of erythromelalgia patients

doi: 10.1097/j.pain.0000000000001511

Figure Lengend Snippet: The IEM mutation changes action potential characteristics. (A) Representative action potentials recorded in IEM 2 (left) and Ctrl 2 (right) nociceptors. Action potential thresholds for each particular neuron are indicated. Dotted line represents 0 mV. (B) The RMP was −47.7 ± 2.4 mV for IEM and −39.3 ± 3.3 for Ctrl nociceptors (n = 24 and 22; P = 0.05 unpaired t test: t = 2.07, df = 44). (C) The action potential threshold was significantly lowered in IEM nociceptors (−45.9 ± 0.6 mV in IEM and −40.1 ± 2.8 mV in Ctrl; n = 23 and 21; P = 0.02, Mann–Whitney test). (D) IEM nociceptors display a stronger hyperpolarization after each action potential (−61.2 ± 0.8 mV for IEM and −45.9 ± 3.7 mV for Ctrl; n = 23 and 21; P < 0.0001, Mann–Whitney test). (E) IEM action potentials had a mean amplitude of 120.9 ± 1.7 mV, compared with 103.1 ± 4.3 mV in Ctrl nociceptors (n = 23 and 21; P = 0.004, Mann–Whitney test). (F) Action potentials in IEM nociceptors had a mean half-width of 2.3 ± 0.6 ms, compared with 8.5 ± 3.8 ms in Ctrl nociceptors (n = 23 and 21; P = 0.02, Mann–Whitney test). (G) The time from pulse onset to the action potential peak is significantly shorter in IEM nociceptors (28.6 ± 2.4 ms, compared with 56.8 ± 11.8 ms in Ctrl; n = 23 and 21; P = 0.019, unpaired t test: t = 2.44, df = 42). (H) Nociceptors for IEM patients have a steeper maximum slope of the action potential upstroke (223.7 ± 13.2 V/s, compared with 136.3 ± 29 V/s in Ctrl; n = 23 and 21; P = 0.007, unpaired t test: t = 2.83, df = 42). (I) The slope of the subthreshold depolarization is not different between IEM and Ctrl nociceptors (1.5 ± 0.1 V/s for IEM vs 1.8 ± 0.3 V/s for Ctrl; n = 23 and 21; P = 0.8, Mann–Whitney test). (J) Action potential (AP) frequency induced by increasing stepwise current injections (n = 14 for IEM and n = 5 for Ctrl; note that some traces are overlaid). None of the measured Ctrl nociceptors fired more than 2 action potentials. The current injection protocol is identical to the one in Supplementary Fig. S5b (available at http://links.lww.com/PAIN/A749 ). Neurons were held at an RMP around −70 mV and depolarized by square current injections in steps of 0.5 × rheobase to evoke action potential firing. IEM, inherited erythromelalgia; RMP, resting membrane potential.

Article Snippet: Induced pluripotent stem cell–derived neurons were stained with anti-peripherin (clone sc-7604; Santa Cruz Biotechnology), anti-β-III-tubulin (clone TUJ-1; R&D Systems), anti-Na V 1.8 (clone ASC-016, 1:1000, see Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ), and anti-TRPV1 (clone ACC-030, 1:1000; all from Alomone Labs, Jerusalem, Israel).

Techniques: Mutagenesis, MANN-WHITNEY, Injection, Membrane

Voltage-clamp protocol to measure TTX-s currents of iPS cell–derived nociceptors. (A–F) Example recordings from a Ctrl 2 nociceptor explain the protocols used in voltage-clamp recordings on iPS cell–derived cells. (A) Shown is the prepulse protocol, used to eliminate space clamp artifacts in this particular Ctrl 2 neuron. The protocol consisted of a short prepulse (generally 4-6 ms, −50 to −15 mV), followed by a repolarizing interpulse (generally 1 ms, −120 to −70 mV), followed by the regular testpulse (40 ms, −80 to +40 mV, 10 mV increments). Prepulse and interpulse voltage and duration were adjusted to each cell individually to eliminate artefacts (F) and obtain optimal voltage-clamp conditions. When tested in Na V 1.7-expressing HEK293 cells, such prepulse protocols did not affect voltage dependence of activation of Na V 1.7 and provided measurable current amplitudes during the testpulse (Supplementary Fig. S6, available at http://links.lww.com/PAIN/A749 ). (B) Total current measured in this particular neuron using the protocol shown in (A) before application of TTX. (C) TTX-resistant (TTX-r) current obtained from the same neuron after application of 500 nM TTX. (D) The TTX-sensitive (TTX-s) current component was calculated by subtracting the TTX-r current (C) from the total current (B). (E) Current–voltage (IV) relationships of the same neuron, obtained from the total current (black) shown in (B), the TTX-r current (blue) shown in (C), and the TTX-s current (red) shown in (D). The IV relationships confirm accurate voltage-clamp conditions, achieved by the prepulse protocol shown in (A). Incomplete inactivation of Na V s during the interpulse (here −70 mV) prevents current from reaching zero before the onset of the test pulse (see also B). (F) A regular voltage protocol without prepulse (40 ms, −80 to 40 mV, 10 mV increments) was run on the same neuron at the end of the recording after TTX had already been applied. The recorded TTX-r current shows bad voltage clamp and components from multiple cells, visible as delayed inward current peaks (red and blue with arrows). This confounds current–voltage analysis. iPS cell, induced pluripotent stem cell.

Journal: Pain

Article Title: The role of Na v 1.7 in human nociceptors: insights from human induced pluripotent stem cell–derived sensory neurons of erythromelalgia patients

doi: 10.1097/j.pain.0000000000001511

Figure Lengend Snippet: Voltage-clamp protocol to measure TTX-s currents of iPS cell–derived nociceptors. (A–F) Example recordings from a Ctrl 2 nociceptor explain the protocols used in voltage-clamp recordings on iPS cell–derived cells. (A) Shown is the prepulse protocol, used to eliminate space clamp artifacts in this particular Ctrl 2 neuron. The protocol consisted of a short prepulse (generally 4-6 ms, −50 to −15 mV), followed by a repolarizing interpulse (generally 1 ms, −120 to −70 mV), followed by the regular testpulse (40 ms, −80 to +40 mV, 10 mV increments). Prepulse and interpulse voltage and duration were adjusted to each cell individually to eliminate artefacts (F) and obtain optimal voltage-clamp conditions. When tested in Na V 1.7-expressing HEK293 cells, such prepulse protocols did not affect voltage dependence of activation of Na V 1.7 and provided measurable current amplitudes during the testpulse (Supplementary Fig. S6, available at http://links.lww.com/PAIN/A749 ). (B) Total current measured in this particular neuron using the protocol shown in (A) before application of TTX. (C) TTX-resistant (TTX-r) current obtained from the same neuron after application of 500 nM TTX. (D) The TTX-sensitive (TTX-s) current component was calculated by subtracting the TTX-r current (C) from the total current (B). (E) Current–voltage (IV) relationships of the same neuron, obtained from the total current (black) shown in (B), the TTX-r current (blue) shown in (C), and the TTX-s current (red) shown in (D). The IV relationships confirm accurate voltage-clamp conditions, achieved by the prepulse protocol shown in (A). Incomplete inactivation of Na V s during the interpulse (here −70 mV) prevents current from reaching zero before the onset of the test pulse (see also B). (F) A regular voltage protocol without prepulse (40 ms, −80 to 40 mV, 10 mV increments) was run on the same neuron at the end of the recording after TTX had already been applied. The recorded TTX-r current shows bad voltage clamp and components from multiple cells, visible as delayed inward current peaks (red and blue with arrows). This confounds current–voltage analysis. iPS cell, induced pluripotent stem cell.

Article Snippet: Induced pluripotent stem cell–derived neurons were stained with anti-peripherin (clone sc-7604; Santa Cruz Biotechnology), anti-β-III-tubulin (clone TUJ-1; R&D Systems), anti-Na V 1.8 (clone ASC-016, 1:1000, see Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ), and anti-TRPV1 (clone ACC-030, 1:1000; all from Alomone Labs, Jerusalem, Israel).

Techniques: Derivative Assay, Expressing, Activation Assay

Proposed distribution of Na V channels during action potential generation. Top: schematic representations of action potentials from wild-type (WT, left) or Na V 1.7/I848T (right) nociceptors. The individual phases of the action potential are shaded in different colors to match the assumed contribution of different Na V isoforms to each particular phase. Bottom: schematic activation curves for the different Na V channel categories, based on the data presented in this study. We propose that in the wild-type (left panel) Na V 1.1, 1.2, 1.3, 1.6, and 1.9 (purple) contribute mainly to subthreshold depolarizations because their voltage dependence is very hyperpolarized. Na V 1.7 (red) has a more depolarized activation curve and defines the action potential threshold but also contributes to the upstroke. Na V 1.8 (blue) with its very depolarized activation contributes mainly to the action potential upstroke. In patients carrying the IEM mutation Na V 1.7/I848T (right panel), activation of Na V 1.7 is crucially shifted towards negative potentials. This leads to more synchronized activation of Na V 1.7 and other TTX-s Na V s (note the vicinity of the red and purple activation curves). This synchronized activity leads to a lowering of the action potential threshold and to a speeding up of the upstroke. It is possible that Na V 1.2 and 1.3 now also contribute to the action potential upstroke in addition to Na V 1.7 and 1.8. This further enhances slope and amplitude of the action potential upstroke. Taken together, action potentials in IEM (I848T) patients are faster and larger and display particular changes, summarized on the right. Comparing the 2 graphs of activation curves (bottom panel), please note the shorter X-axis in the bottom right graph. We do not propose a shift of either the purple or the blue (Na V 1.8) activation curve. IEM, inherited erythromelalgia.

Journal: Pain

Article Title: The role of Na v 1.7 in human nociceptors: insights from human induced pluripotent stem cell–derived sensory neurons of erythromelalgia patients

doi: 10.1097/j.pain.0000000000001511

Figure Lengend Snippet: Proposed distribution of Na V channels during action potential generation. Top: schematic representations of action potentials from wild-type (WT, left) or Na V 1.7/I848T (right) nociceptors. The individual phases of the action potential are shaded in different colors to match the assumed contribution of different Na V isoforms to each particular phase. Bottom: schematic activation curves for the different Na V channel categories, based on the data presented in this study. We propose that in the wild-type (left panel) Na V 1.1, 1.2, 1.3, 1.6, and 1.9 (purple) contribute mainly to subthreshold depolarizations because their voltage dependence is very hyperpolarized. Na V 1.7 (red) has a more depolarized activation curve and defines the action potential threshold but also contributes to the upstroke. Na V 1.8 (blue) with its very depolarized activation contributes mainly to the action potential upstroke. In patients carrying the IEM mutation Na V 1.7/I848T (right panel), activation of Na V 1.7 is crucially shifted towards negative potentials. This leads to more synchronized activation of Na V 1.7 and other TTX-s Na V s (note the vicinity of the red and purple activation curves). This synchronized activity leads to a lowering of the action potential threshold and to a speeding up of the upstroke. It is possible that Na V 1.2 and 1.3 now also contribute to the action potential upstroke in addition to Na V 1.7 and 1.8. This further enhances slope and amplitude of the action potential upstroke. Taken together, action potentials in IEM (I848T) patients are faster and larger and display particular changes, summarized on the right. Comparing the 2 graphs of activation curves (bottom panel), please note the shorter X-axis in the bottom right graph. We do not propose a shift of either the purple or the blue (Na V 1.8) activation curve. IEM, inherited erythromelalgia.

Article Snippet: Induced pluripotent stem cell–derived neurons were stained with anti-peripherin (clone sc-7604; Santa Cruz Biotechnology), anti-β-III-tubulin (clone TUJ-1; R&D Systems), anti-Na V 1.8 (clone ASC-016, 1:1000, see Supplementary Fig. S2, available at http://links.lww.com/PAIN/A749 ), and anti-TRPV1 (clone ACC-030, 1:1000; all from Alomone Labs, Jerusalem, Israel).

Techniques: Activation Assay, Mutagenesis, Activity Assay

Three-dimensional structures of spider-derived ICK peptides. Protein Data Bank ID numbers for NMR structures of (a) ProTx-I and (b) GsMTx-4 are 2M9L and 1TYK, respectively. 3D structure models of (c) GTx1-15 were constructed by homology modeling with ICM-PRO (Molsoft, La Jolla, CA) based on NMR structures of HnTx-IV (PDB: 1niy). (d) NMR structure of ProTx-II by Park et al. . Reprinted with permission from . Copyright: 2014 American Chemical Society. β -Sheets are indicated as green or black arrows and disulfide bonds are highlighted with yellow. Note: spider-derived ICKs have only two antiparallel β -sheets and three disulfide bonds except for ProTx-II which has only one β -sheet.

Journal: International Journal of Peptides

Article Title: High Proteolytic Resistance of Spider-Derived Inhibitor Cystine Knots

doi: 10.1155/2015/537508

Figure Lengend Snippet: Three-dimensional structures of spider-derived ICK peptides. Protein Data Bank ID numbers for NMR structures of (a) ProTx-I and (b) GsMTx-4 are 2M9L and 1TYK, respectively. 3D structure models of (c) GTx1-15 were constructed by homology modeling with ICM-PRO (Molsoft, La Jolla, CA) based on NMR structures of HnTx-IV (PDB: 1niy). (d) NMR structure of ProTx-II by Park et al. . Reprinted with permission from . Copyright: 2014 American Chemical Society. β -Sheets are indicated as green or black arrows and disulfide bonds are highlighted with yellow. Note: spider-derived ICKs have only two antiparallel β -sheets and three disulfide bonds except for ProTx-II which has only one β -sheet.

Article Snippet: GTx1-15 was obtained from Alomone Labs (Jerusalem, Israel).

Techniques: Derivative Assay, Construct